RLTR10B (DF0004112)

Model

Details

Model (version: ) Seed source: Repbase + RepeatMasker
Length 292
Seed Sequences 303
Author(s) Finn RD, Hubley R, Jones T, Jurka J, Smit A, Wheeler T
Clade
  • Mus
Model Masking None
Consensus Sequence
(model derived)
Show
>DF0004112:RLTR10B TGTGGGAAGCCGTTGCAGAGTGGCAGTTGCAGAGTGGCAGTTGGCTACTGCTGGCCACCACACATACATAGGCAGTAAAGGTTCTTTTGCCAAGATGAGAGAAAGTTAACCAATCAGATGAGAGACAAGTTAACCAATCAGATGTGAGACACGCCTCTCCTAGGCCTATATAAGCAGCACCAGTTCTGGGCTCGGGGTCTTTTCGCCTCTACAATCAAGCTCTCCCAATAAACGTGTGCAGAAGGATCCTGTTGCAGCGTCGTTCTTCCTGGCCAGTCGAGCGCGCGCAAGA

Genome Specific Characteristics

Non-Redundant Coverage, Conservation, and Inserts

Fraction of hits covering each position of the model, and per-position sequence identity and insertion rate based on those hits.

Non-Redundant Coverage

Number of aligned bases per model position, among the non-redundant hits in dfamseq.

Redundant Coverage

Number of aligned bases per model position, using the hits in dfamseq.

False Coverage

Number of aligned bases per model position, using the hits from an artificial sequence devoid of TEs.

Seed Coverage

Number of aligned bases per model position in the 303 deep seed alignment.

Seed Whisker Plot

Representation of the 303 seed alignment sequences, indicating their length distribution across the model.