Copia-7-I_DR (DF0003897)

LTR retrotransposon from zebrafish: internal sequence


The translation product of pos 18-401 match the Gypsy-gag-like protein from Copia-8_DR. Beware: from pos 1064 on this sequence is a VNTR, (accctccagagctgccag)n, (aatggccgccgcctcctgagcttcc)n and finally (acgctccaggccctccgcagctcc)n. It is dangerously skewed (very C-rich) and gives false positive matches to CpG islands like the promoter region of L1 in mammals, even with complexity adjusted scores.


Accession Name Wikipedia
Type Retrotransposon Article
Class LTR Article
Superfamily Gypsy? Article

Note: Uncertain classification.

Hit Statistics

The model is 3222 positions long. The average length of non-redundant hits to the model is 505.4. This table shows the number of hits above score thresholds:

Species Gathering Trusted
non-redundant all hits non-redundant all hits
Danio rerio 505 1537 492 1461

External Database Links