DNA-AT-4_DR (DF0002836)

Model

Details

Model (version: ) Seed source: Repbase + RepeatMasker
Length 951
Seed Sequences 85
Author(s) Finn RD, Hubley R, Jones T, Jurka J, Smit A, Wheeler T
Clade
  • Danio rerio
Model Masking None
Consensus Sequence
(model derived)
Show
>DF0002836:DNA-AT-4_DR AGACCTTTTACGCACTTCCGCATTTTTCGAACGGAAATACGTCAATGTAGTGCATTAGAACTTCCTGTTATCATAGCGGCAGATACGAAAAATGGCAGAGTCGAAGAATCGCAGTTTCTGTTGTGTTCCAGGCTGTTCGTCTTCTAACCAAAAACAGCCCTACCTTTTATTTCATTCTTTTCCTGTGGATCCAAACCTGAAACCCAAATGGATACAGGCGATCTGAAGAGAGGAAGGGCATAGTTTTAATGTAAAAACAGGTAGCACCTATGTCTGCAGCCGGCACTTCGCTCCGGATGATTACAGTGGTGGCTGCGTCGTTCGTCGCCTGAAGAGTGGTGTTGTCCCGAGCCTATTCCCTTGGAACAACTTTACAGCTCCTTTGAGAAGGGAGTCAGTATATGACAGAACCTACAAACGTCAGTCTAAACAGCTATGCTGTGAAGATAGCGACATGGTGGCTAAGGCAGCAAGGATGGATCACGACTACGTGACACACCCACCTGCATTTATCCCACCTGCAGGTAAGATTGTTCATAGTGTATTTAGTTAACGCTAGTCACCTGTGTGTACCGTTATGCATATCTACCTGAACAAATTAATGTTAATAATATAAGCTGTTCACGAAACTCAACTAATAAAATAAAATATATATTTTTTTTAATAATGAAACAATTTATTGCTGTGACATCTAGTAAATACACAAAGTTTTATCATACTAGCATGTGTGGAAGTATTTAAAACAAGTGTGTTACAACTGGCCCTGTGTTAGGTTCTGCCCCGCTCTCCCCTATTTTAATTGCATGTATTTAATTACTTATTTAATTAACTTCGGAAGACAACTCAGGCTCGCCGAAAACACTCTAGCTGCCTTTTCTCCGCCAAAAAAACTCATACCGGAACTGGGTTTACACGTTGTTGACGTACTTCCGGTTTTTGCGTAAAAGGTCT

Genome Specific Characteristics

Non-Redundant Coverage, Conservation, and Inserts

Fraction of hits covering each position of the model, and per-position sequence identity and insertion rate based on those hits.

Non-Redundant Coverage

Number of aligned bases per model position, among the non-redundant hits in dfamseq.

Redundant Coverage

Number of aligned bases per model position, using the hits in dfamseq.

False Coverage

Number of aligned bases per model position, using the hits from an artificial sequence devoid of TEs.

Seed Coverage

Number of aligned bases per model position in the 85 deep seed alignment.

Seed Whisker Plot

Representation of the 85 seed alignment sequences, indicating their length distribution across the model.