DIRS1_DR (DF0002639)

DIRS-type LTR retrotransposon from zebrafish

Description

DIRS1_DR is a family of DIRS1-like retrotransposons. These elements are related to Gypsy-like LTR retrotransposons and endogenous retroviruses. There are ~100 copies of DIRS1a_DR in the genome, they are ~0.3% divergent from the consensus sequence. Therefore, this family retrotransposed in the zebrafish genome very recently. The unusual structure of DIRS1_DR is depicted in the next figure. GTTCCCCTTCGGTTGGGGAACTTCAGTGCCATGAATGGGAGGATTCGGATCAGAAGCCGCTTATCTGGAG <====== ======> <--------------------------------------------- AGTATTGAACGGGCCAATGAATGAAATTAATTGGCAGCGTAAGCTTGCGCAGGTGTGCGACATCTGCAAT ---------------------------------------------------------------------- TATCTCAGCATATAAGCACACCTGAAGCCAGCAGACGCCATCCTTTTCGCTTCAGATCCTTTCTGAGTGA ----------------------------------------------- ...................................................................... ...................................................................... GGTGCAGTCATTATGGCGCTTTCCATATTCTCCCATTCATGGCACTGAAGTTCCCCAACCGAAGGGGAAC <====== ======> <~~ GTTCGAGGTTACAGAAGTAACCCTTCGTTCCCCGAGGAGGGGAACGGAAGTGCCATATTCCGTCGCCATA ~~~~~~~~~~~~~~~~~~~~~~~~~~<====== ======> ATGACTGTCCCTTAGCTGTTTGAAAGTCTCTTCAGCTT AAAAGGATGGCGTCTGCTGGCTTCAGGTGTGCTTATATGCTGAGATAATTGCAGATGTCGCACACCTGCG ---------------------------------------------------------------------- CAAGCTTACGCTGCCAATTAATTTCATTCATTGGCCCGTTCAATACTCTCCAGATAAGCGGCTTCTGATC ---------------------------------------------------------------------- CGAATCCTCCCATTCATGGCACTTCCGTTCCCCTCCTCGGGGAACgaagggttacttctgtaacctcgaacgtt ----------------------> <====== ======>~~~~~~~~~~~~~~~~~~~~~~~~~~~~> Fig.1 Termini of DIRS1_DR. The 163-bp sub-terminal inverted repeats are underlined by a single line. DIRS1_DR encodes three ORFs. ORF1 (positions 414-1632) codes for the gag-like protein. ORF2 (positions 1633-2597) codes for reverse transcriptase and RNase H. ORF3 (positions 2598-5129) codes for the phage integrase.

Classification

Accession Name Wikipedia
Type Retrotransposon Article
Class LTR Article
Superfamily DIRS

Hit Statistics

The model is 6132 positions long. The average length of non-redundant hits to the model is 2988.4. This table shows the number of hits above score thresholds:

Species Gathering Trusted
non-redundant all hits non-redundant all hits
Danio rerio 1672 25004 1628 19813

External Database Links

  • Repbase : DIRS1_DR [Requires Repbase registration]