Tx1-50_DR (DF0002318)

Non-LTR retrotransposon from zebrafish

Description

~98% identical to consensus. Many copies are truncated and parts of tRNA gene array. It follows a fragment of tRNA-Gly (GCATTGGTGGTTTAGTGGTAGAATTCTCGTC).

References

  1. The zebrafish reference genome sequence and its relationship to the human genome.
    Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, Collins JE, Humphray S, McLaren K, Matthews L, McLaren S, Sealy I, Caccamo M, Churcher C, Scott C, Barrett JC, Koch R, Rauch GJ, White S, Chow W, Kilian B, Quintais LT, Guerra-Assunção JA, Zhou Y, Gu Y, Yen J, Vogel JH, Eyre T, Redmond S, Banerjee R, Chi J, Fu B, Langley E, Maguire SF, Laird GK, Lloyd D, Kenyon E, Donaldson S, Sehra H, Almeida-King J, Loveland J, Trevanion S, Jones M, Quail M, Willey D, Hunt A, Burton J, Sims S, McLay K, Plumb B, Davis J, Clee C, Oliver K, Clark R, Riddle C, Elliot D, Eliott D, Threadgold G, Harden G, Ware D, Begum S, Mortimore B, Mortimer B, Kerry G, Heath P, Phillimore B, Tracey A, Corby N, Dunn M, Johnson C, Wood J, Clark S, Pelan S, Griffiths G, Smith M, Glithero R, Howden P, Barker N, Lloyd C, Stevens C, Harley J, Holt K, Panagiotidis G, Lovell J, Beasley H, Henderson C, Gordon D, Auger K, Wright D, Collins J, Raisen C, Dyer L, Leung K, Robertson L, Ambridge K, Leongamornlert D, McGuire S, Gilderthorp R, Griffiths C, Manthravadi D, Nichol S, Barker G, Whitehead S, Kay M, Brown J, Murnane C, Gray E, Humphries M, Sycamore N, Barker D, Saunders D, Wallis J, Babbage A, Hammond S, Mashreghi-Mohammadi M, Barr L, Martin S, Wray P, Ellington A, Matthews N, Ellwood M, Woodmansey R, Clark G, Cooper J, Cooper J, Tromans A, Grafham D, Skuce C, Pandian R, Andrews R, Harrison E, Kimberley A, Garnett J, Fosker N, Hall R, Garner P, Kelly D, Bird C, Palmer S, Gehring I, Berger A, Dooley CM, Ersan-Ürün Z, Eser C, Geiger H, Geisler M, Karotki L, Kirn A, Konantz J, Konantz M, Oberländer M, Rudolph-Geiger S, Teucke M, Lanz C, Raddatz G, Osoegawa K, Zhu B, Rapp A, Widaa S, Langford C, Yang F, Schuster SC, Carter NP, Harrow J, Ning Z, Herrero J, Searle SM, Enright A, Geisler R, Plasterk RH, Lee C, Westerfield M, de Jong PJ, Zon LI, Postlethwait JH, Nüsslein-Volhard C, Hubbard TJ, Roest Crollius H, Rogers J, Stemple DL;
    Nature 2013;496:498-503. Pubmed

Classification

Accession Name Wikipedia
Type Retrotransposon Article
Class LINE
Superfamily L1-Tx1

Hit Statistics

The model is 2813 positions long. The average length of non-redundant hits to the model is 1446.8. This table shows the number of hits above score thresholds:

Species Gathering Trusted
non-redundant all hits non-redundant all hits
Danio rerio 40 1201 36 691

External Database Links

  • Repbase : Tx1-50_DR [Requires Repbase registration]