HelitronY1A_CE (DF0001408)

HELITRONY1A_CE is a family of non-autonomous Helitron DNA transposons

Description

A 35-bp minisatellite, TGGCGGGAAATTCAAATTTTCAGTGAAAAAAATTT, is harbored and propagated by HELITRONY1A_CE.

References

  1. Rolling-circle transposons in eukaryotes.
    Kapitonov VV, Jurka J;
    Proc Natl Acad Sci U S A 2001;98:8714-8719. Pubmed

Classification

Accession Name Wikipedia
Type DNA Transposon Article
Class Rolling Circle
Superfamily Helitron Article

Hit Statistics

The model is 3084 positions long. The average length of non-redundant hits to the model is 919.5. This table shows the number of hits above score thresholds:

Species Gathering Trusted
non-redundant all hits non-redundant all hits
Caenorhabditis elegans 1628 7669 757 3552

External Database Links