HERVE (DF0000174)

Model

Details

Model (version: 4) Seed source: Repbase + RepeatMasker
Length 7813
Seed Sequences 177
Author(s) Finn RD, Hubley R, Jones T, Jurka J, Smit A, Wheeler T
Clade
  • Hominoidea
Model Masking None
Consensus Sequence
(model derived)
Show
>DF0000174:HERVE tttcttggttccctgaccgggaagcgaggtaattgacggacggtcgaggcagccctttaggcggcttaggcctgccctgtggagcatccctgcgggggactccggccagcttgagcgacgcggatcctgagagcgctcccgggtaggcaattgccccggtggaatgcctcgtcagagagtgtgtggcaggcccccgtggaggatcaacgcagtggctgaacaccgggaaggaacaggcacttggagtccggacatttgaaacttggtaagactggtctttggaacttgcccactccatttgagtggaagcgtggcctgatcacccacggcgtgcctgtactggcactttggtttttgtttttgacttgacttgaattgcttgatactttggttttggtttgacctggcttggatttctggatactctgattttggttttgattctggtttggtgaaaactgaaaaagtgtgtgtgtgccctttttacccattctttgttctgtggtgtgcgtgtggtgtgagcttggtgttttgtctcgaggaaacgtgggtcagacacaaagtaagcctactccgctaggaactatgttgaaaaattttaagaaaggatttaatggagactatggggttactatgacaccagggaaacttagaactttgtgtgaaatagattggccaacattagaagtgggttggccatcagaaggaagcctggacaggtcccttgtttctaaggtatggcacaaggtaactggtaagtcaggacactcagaccagtttccatacatagacacttggttacagctggtgctagaccccccacagtggctaagagggcaggcagcagcagtgctagtagcaaagggacagatagccaaggaaggatcccgctccacccgccgagggaaatcaactcctgaagttctgttcgacccaacatcagaagatccattgcaggagatggcaccagtgatcccagtggtgccctccccttaccagggagagaggctccccacttttgagtccacagtgcttgcgcctccgcaagacaaacatatccctaggccacccagagtagacaagagaggaggtgaggactcgggagaaacccctcccttggcagctcgtttacgacccaaaacggggatacaaatgcccctgagagagcagcggtatactgggatagatgaggatggtcacgtggtggagaggcgtgtttttgggtaccagcccttcacctctgccgaccttctcaactggaaaaacaataccccgtcctataccgaaaagccacaagctctaattgatttgctccaaactgttatccagacccacaaccccacctgggctgattgccaccagttgctcatgttcctctttaacagagatgaaaggcggagagtgctccaagcagcaactaagtggctagaggaacatgcaccagctgattatcaaaacccccaagagtatggaaggacccagttaccaggaaccgacccccagtgggacccacatgaaagagaggatatgcaaaggctaaaccgagacagggaagctctcttggaaggattaaagaggggagctcagaaggccacaaacgttaacaaggtctctgaggtcattcagggaaaagaagaaagtccagcacaattctacgagagactgtgtgaggcctatcgtatgtatactccctttgatcccgatagccctgaaaatcagcgcatgattaacatggctttagtcagtcaaagcgcagaagacattagaagaaaactgcagaaacaggctgggcttgcagggatgaatacatcacagttattagaaatagctaaccaggtgtttgtaaacagggatgcagtaagccgtaaggaaaccgcaaagagaatggaggtcaggcccggcgaaacgcacctgttagctgcagcaatcagaggggtccccccaaaagaggcaagggagaaggggggccctgggaaagaaactcagcttggctgtcagagtttgcagcgtaaccagtgtgcttattgtaaagaaataggacattggaagaacaaatgccctcagctcaaaagaaaacaaggtgactcagagcaggaggccccggacaaggaggaaggggccctgctcaacctggcagaagggttattggactgagggggaccgggctcaagtgtccccaaagagcctctggtcagaatgacagtcgggggtagagacattgattttcttgtagataccggtgctgaacattcggtagtaaccgccccggtcgcccccttatccaaaaagactattgacatcatcggagccacgggggtttcagcaaagcaagctttctgcttgcctcggacttgtactgtaggaggacataaagtgattcatcagtttttgtacatgcctgactgtcccttgcccttgttgggaagggacttgcttagcaagctgagagccactatctcttttacagagcatggctctttgctgctaaagttacccggaacgggagtcattatgacccttatggtcccccgagaggaggaatggagacttttcttaactgagccgggccaagagataagaccagctctggctaagcggtggccaagagtatgggcagaagacaaccctccagggttggcagtcaaccaagcccccgtacttatagaagttaagcctggggcccagccggttaggcaaaaacaggacccggtccccagagaagctcttcaaggtatccaggtccatctcaagcacctaagaacttttggaattatagttccttgtcagtctccatggaacactcccctcctgcctgttcccaagccacggaccaaggactacaggccggtacaggatttgcgcttgcttaatcaagctacagtgactttacatccaacagtacctaacccgtacacattgttggggttgctgccagctgaggacagctggttcacctgcttggacctgaaagacgctttctttcgtatcagattagcccctgagaggcagaagctgtttgcctttcagtgggaagatccggagtcaggtgtcactactcagtacacttggaccgggcttccccaagggttcaagaactcccccaccatcttcggggaggcgttggctcgagacctccagaagtttcccaccagagacctaggctgcgtgttgctccagtaggttgatgaccttttgctgggacaccccacggcagtcgggtggccaagggaacagatgccctactccggcacctggaggactgtgggtataaggtgtccaagaagaaaagctcagatctgccgacagcaggtacgttacttgggatttactatccgacagggggaacgcagcccgggatcagaaagaaagcaggtcatttgcaatctaccggagcctaagagcagaaggcaggtgagagaattcttaggagctgtggggttttgtagactgtggatcccaaactttgcagtattagccaagcctttgtatgaggtcacaaaggggggggaccgggaacctttggaatggggatcccaacaacagcaagtctttcatgagttaaaggaaaaacttctggcagccccagccctggggctacccgatctgacaaagccttttccattgtatgtgtcagagagagaaaagatggcagctggacttttaacccaaactgtggggccctggctgaggccggtggcctacctctctaaacaactagacggggtttctaaaggatggcccccctgtttgagggccttggcagcaactgccctgctagtacaagaagcaaataagctgactcttgggcaaaacctgaacataaaggccccccatgctgtggtgactttaatgaatactaaaggacatcattggctaacgaatgctagactcaccaagtaccaaagtttgctctgtgaaaatccccgtataaccattgaagtttgtaacaccctgaaccccgccaccttgctcccggtatcagagagccctgtcgagcatgattgtgtagaagtgttggactcagttgactctgggcatcagtagactgggaactatacgtggatgggagcagcttcatcaacccacaaggagagagaggtgcagggtatgcagtggtaaccctggacactgttgttgaagccagatcgttgccccagggcacttcagcccagaaagctgaactcattgctttcattcgggccttagaactcagtgaaggtgagactgtcaacatttacactgattctcggtatgcctttttaacccttcaagtgcatggagcatgatagaaagaaaagggcctattgaactctgggggaaaagacataaaatatcaacaagaaatcttgcaattattagaagcagtatggaaaccccacaaggtggcagttatgcattgcagaggacaccagcgagcttccaccttggtgggtttggggaattcccgcgctgactcagaggctcgaaaagcagcatctgcccttccgggcatcagtcacagcccccctgctccctcaagcacctgatcttgtacctacttattctaaagaagaaaaggactttctccaggtagagggaggacaagtgatggaggaaggatggattcggttaccagatgggagagtagctgtgccacagctgctaggagctgcagttgtactggctgtgcatgaaaccacccatctaggtcaggagtcacttgaaaagttgttaggccggtatttctacatctcgcatttgtcagcccttgccaaaacggtgaggcagcggtgtgttacctgccgacagcatgatgcgaggcaaggtccagccgttccgcccggcatacaagcttatggagcagccccctttgaagatctccaggtggacttcacagagatgccaaagtgtggaggtaacaagtatttactagttcttgggcgtacctactctgggtgggtggaggcttatccaacacgaactgagaaagctcgtgaagtaacccgtgtgcttcttcgagatcttattcctagatttggactgcccttacggatcggctcagataacgggcctgcgtttgtggctgacttggtacagaagacggcaaaggtattggggatcacatggaaactgcatgccgcctcccggcctcagagttccggaaaggtggagcggatgaatcggactatcaaaaatagtttagggaaagtatgtcaggaaacaggattaaaatggatacaggctctccctatggtattatttaaaattagatgtaccccttctaaaagaacaggatattccccttatgaaatattatatcataggccccctcccatattgcggggacttccaggcactccctgagagttaggtgaaattgagttacagcgacagctacaggctttaggaaaaattacacaaacaatctcagcctgggtaaatgagagatgccctgttagcttattctccccagttcaccctttctccccaggtgatcgagtgtggatcaaggactggaacgtagcctctttgtgtccacggtggaaaggaccccagactgtcgtcctgaccactcccaccgctgtgaaggtagagggaatcccagcctggatccaccacagccatgtaaaacctgcagcgcctgaaacctgggaggcaagaccaagcccagacaacccttgcagagtgaccctgaagaagacgacaagccctgctccagtcacacccggaagctgactggtccacgcacggccgaagcatgaggaagctcatcgtgggattcatttttcttaaattttggacttatacagtaagggcttcaactgaccttactcaaactggggactgttcccagtgtattcatcaggtcactgaggtaggacagcaaattaaaacaatctttctgttctatagttattatgaatgtatgggaacattaaaagaaacttgtttgtataatgccactcagtacaaggtatgtagcccgggaaatgaccgacctgatgtgtgttataacccatctgagccccctgcaaccaccgtttttgaaataagattaagaactggccttttcctaggtgatacaagtaaaataataactagaacagaagaaaaagaaatccccaaacaaataactttaagatttgatgcttgtgcagccattaatagtaaaaagctaggaataggatgtggttctcttaactgggaaaggagctacagagtagaaaataaatatgtttgtcatgagtcaggggtttgtgaaaattgtgcctattggccatgtgttatttaggctacttagaaaaagaacaaaaaggacccggttcatcttcagaagggggaagccaacccctcctgtgctgccggtcactgtaacccactagaactaataattaccaatcccctagatccccgttggaaaaagggagaacgtgtaaccctggggatcgatgggacagggttaaacccccaagttgccattttagttagaggggaggtccacaagcgctctcccaaaccagtgtttcaaaccttttatgaggagctgaatctgccagcaccagaacttccgaaaaagacaaaaaatttgtttctccaattagcagaaaatgtagctcattcccttaatgttacttcttgttatgtatgcgggggaaccactatcggagaccgatggccttgggaagcccgagagttggtgcctactgatccagctcctgatataattccagttcagaaggcccaagctagcaacttctgggtcctaaaaacctcaattattggacaatactgtatagctagagaagggaaagactttatcatccctgtaggaaagcttaattgtataggacagaagttgtataacagcacaacaaagacaattacttggtggggcctaaaccacactgaaaagaatccatttagtaaattttctaaattaaaaactgcttgggctcatccagaatctcatcaggactggacggctcccgctggactatactggatatgtgggcacagagcctacattcggttacctaataaatgggcaggcagttgtgttattggcactattaagccgtcctttttcttattacccataaaaacgggtgagctcctaggtttccctgtctatgcctcccgagaaaagagaggcatagttataggaaactggaaagataatgagtggccccctgaaaggatcatacagtattatgggcctgccacatgggcacaagacggctcatggggataccgaacccccatctacatgctcaatcggatcatacggttgcaggccatcttagaaataattactaatgaaactggcagagctttgactgttttagcttggcaggaaacccaaatgaggaatgctatctatcagaatagactggccttggactacttgctagtagctgaaggaggagtttgtggaaaatttaacttaaccaattgctgcctacaaatagatgatcaaggacaggtggttgaaaacatagtcagggacatgacaaaggtggcacatgtgcctgtacaggtttggcacgagtttaatcctgagtctttatttggaaaatggtttccagctataggaggatttaaaaccctcattgtaggtgtattgctagtgataggaacttgcttgctgctcccctgtgtattacccttgctttttcaaatgataaaaggttttgttgctactttggttcatcagaaaacttcagcacacgtgtattatatgaatcactatcgctctatctcacaaagagactcagaaagtaaagatgagagtgagaactcccactaaaagtgaaaattctcaaaggggggaaaa

Genome Specific Characteristics

Non-Redundant Coverage, Conservation, and Inserts

Fraction of hits covering each position of the model, and per-position sequence identity and insertion rate based on those hits.